 |
|
|
| Cat No. |
Conc. |
Size |
Qty |
List Price* |
My Price |
Ordering |
|
|
| BIO-21055 |
20u/µl |
5000u |
1 |
$55.00
|
$55.00
|
 |
|
|
|
|
Please contact
info@bioline.com for Bulk, Custom & OEM services.
*Please login or
register to view and apply custom discounts.
|
|
|
- Features
- High stringency for the T7 promoter
- High level of purity, specificity and activity
- Readily incorporates NTPs
- Available in a stand-alone format or as part of a T7 Transcription kit
- Applications
- Production of RNA and double-strandedRNA for siRNA experiments
- Generation of radioactive RNA probes with high specific activity
- Synthesis of RNA for RNA-protein interaction, splicing and processing studies
- RNA production for in vitro translation
- Description
T7 RNA Polymerase is a DNA dependent RNA polymerase, which catalyzes RNA synthesis in the 5´-3´ direction downstream from any DNA with a T7 promoter sequence. T7 RNA Polymerase can be used to produce RNA from cloned inserts and will incorporate labeled NTPs. Products generated by this enzyme can be used as probes for screening purposes.
- T7 Promoter Sequence
RNA transcription using T7 RNA Polymerase is dependent upon the presence of a T7 promoter sequence in the DNA template being transcribed:
5´ TAATACGACTCACTATAGGGAGA 3´
The red sequence represents the minimum promoter sequence required for efficient transcription, with the blue G being the first base incorporated into the resulting RNA. The final 4 bases (GAGA) are not necessary, but many templates will show enhanced efficiency and yield if those extra bases are present.
- Double-Stranded Transcription
Whilst most users will require single-stranded RNA, the T7 RNA Polymerase can be used to make double-stranded RNA for digestion into siRNA. To achieve this, the DNA template must be flanked by opposing T7 promoters. This can be obtained by including the T7 promoter in both the forward and reverse primer. The resulting transcripts can be annealed to each other by heating to 65°C for 5 minutes and cooling slowly.
- Storage Conditions
T7 RNA Polymerase can be stored for 12 months at –20°C.
- Shipping Conditions
On Blue Ice
- Product Citations
1.Dukes, J.P., et al. Archives of Virology 151(6), 1093-1106 (2006).
2.Fen, C.X., et al. J. Mol. Biol. 371(5), 1238-1248 (2007).
|
|
| |
|
|
|
